Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YL19FM1
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00008152001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001541682.1| Score: 186 E_value: 1e-12
KEGG Definition: ClpB; K03695 ATP-dependent Clp protease ATP-binding subunit ClpB
Accession: cpt:CpB0145 Score: 161 E_value: 4e-10
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1051 Score: 168 E_value: 5e-13
PFAM Definition: AAA_2, ATPase family associated with various cellular activities (AAA). This Pfam entry includes some of the AAA proteins not detected by the pfam00004 model..
Pfam Number: pfam07724 Score: 117 E_value: 3e-07
Swissprot: Q7AJA9|CLPB_CHLPN

Sequence:
>SY0AAB41YL19FM1
TTGGAATTTCTTAACACGAATGAGCGGGAATCGAGCGATCGTTTTCCTGG
ACGAGTTCGAAAAGACAACGCGAGAAGTGCAGAATGCCTGCTTGATTCCT
TTCGACGAAGGGAAGTACGTCGACCGAAGAAACCGGGAAGCTGTGGACTG
TTCAAAGACAATCTGGATCATAGCAACGAACGCGCTAGATCGGAAAATCG
TCGATTTTTGTGAAAAGAACCCAGGCGTCCTCACAAACGACGATCAAGAT
AAACATGCACGACTAATGACCGACTTGGAAAAGACCCTGAAGAAGCAATT
AAAACATACTTTCGGAAACCCCTTGTCCGGTAGAATTTCAGCAGTCCTCC
CCTTCCTCCCTTTCTCCCTCGGCGAACAAGCAGTAGTGGCACACAAATAC
ATCCTCGAACTGAAACACAAAGTCCTGACACCTGTGAACCTCTCCTCGGG
GAAACTGGTCGGGAGAGTACTCTTGCACATCAAGAGCGACGGTGCCGTCT
GCAAAGCTGTGTCAACGGAAGGGTATGATCCGGACCAGGGTGCGCGTTCG
CTGCAGACTGCGGTCAAGACACGTATCGA

Sequences in the Contig:

SY0AAB41YL19FM1