Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YJ22FM1
Length(NT) : 599
Best Gene Model Blast : Link to GSTUMT00010845001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 475 E_value: 4e-46
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 452 E_value: 9e-44
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 251 E_value: 1e-22
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAB41YJ22FM1
TTGGCGAGGAAGTGGTGAGAATACTACTCGGACAGGGAGAGGCCAACCCC
GAGAAACCAAATAATGACGGCCTAACACCGCTCTCGCTTGCCGCTATGAA
TGGACATGAGGGAGTGGTGAAAATACTGCTTGAGCGGGAAGAGGTCAACC
CCAACGAACCAGATAATGACGGCAAAACACCGCTCTCGGCTGCCGCTTGG
GGTGGACATGAGGGAGTGGTGAAAATACTGCTTGAGCGGGAAGAGGTCCA
CCCCGACAAATCAGATAATGGCGGCCAAACACCGCTCTGGGCTGCCGCTT
GGGGTGGACATGAGGGAGTGGTGAAAATACTGCTTGAGCGGGAAGAGGTC
CACCCCGACAAATCAGATAATGGCGGCCAAACACCGCTCTCGGCTGCCGC
TTGGGGTGGACATGAGGGTGTGGTGGGGATACTCCTCGGGATAGAAGATG
TGGACCCTGACAAGCAGGATAACCGAGGGCAGACTCCACTCTCGATCGCT
ACTAGGTACGGCCATAAACGGGTCGTAGCCCTGGTACAGTCTCGTAAGGC
GGTAACCAGAGTTCTGGGAAACACATCTTCGTGATATTTCGCTTCATCC

Sequences in the Contig:

SY0AAB41YJ22FM1