Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YJ04FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00012380001 E-value : 1e-132
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG09586.1
Accession: ref|XP_389762.1| Score: 197 E_value: 2e-25
KEGG Definition: hypothetical protein
Accession: fgr:FG09586.1 Score: 197 E_value: 1e-25
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4680 Score: 140 E_value: 9e-10
PFAM Definition: No Hit Found
Swissprot: Q7RZ85|NPC2_NEUCR

Sequence:
>SY0AAB41YJ04FM1
TTGGCTTCAAACTACTGAGACAATCATGAAGCTTTCTATCTTCGGTCTCA
CTGATTGCGGTGACAGTATCATCGGAAAGCCTGTTCCACAAGCTCGCTAA
GCACTTGGTGCCGCCTACGACTGGGTTGAATGAGATTCCGGGAGACAACC
CTCTAAAATACTGCCATGAGGACCATTCCGGTGATATCTTTACTATCGAG
AAGGTCGACCTGACCCCCAATCCGCCCATCCGTGGGAAACCTCTTACTAC
GCAAGCTGTTGGCGTTCTCAAAGACAAGGTTTCCCGAATAGCACCCATGT
CGACGTTACCGTTAAATATGGCCTCATTACGTTGATGAAGCAGTCACTGA
ACATCTGCGACCATGTGGGTGAGCTTGGCCTCGAATGCCCGATTGATCGA
GGCAGGGTGACGCTGACCCAAGTGGTCGATGTCCCCAAATTTATTCCTCC
CGGAAAGTACACTCTCAAATGCAACGTAACGATCGCCGGTGTCAGGCCCA
TAACGTGCCTCACTGGAACTATCGCATTTGGCGGCTGAATATCCACCTCG
CTTATTTCATGATCAGAAATAATACAATATATCCTTGGTTGCCATGCAGT
CGGTGGGGGGGGACGGTTAGAC

Sequences in the Contig:

SY0AAB41YJ04FM1