Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YI22FM1
Length(NT) : 569
Best Gene Model Blast : Link to GSTUMT00003197001 E-value : 1e-135
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55484.1| Score: 210 E_value: 2e-15
KEGG Definition: DNA or RNA helicases of superfamily II
Accession: aor:AO090005000418 Score: 210 E_value: 9e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q06683|IRC3_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAB41YI22FM1
TTGGCAGCATTCCCCCCCAAAATACCACAGACCATATCCTTCTCACCAAT
TGGATCGTGAAAACACCAGAAGAACCCTTAAAAGACTTCCATTTCGTGCT
CCCTCCTCGCCATATACGACATGAGGAGGGCACTACAGTGTACCCGCGCC
TTCTCCAATCTCTTCTTGCCTTCGCTCTACCGACCAACTCCCTCTTCTCT
ACCGACATTCGCACTCTCATGGCTACCCCAGCGGGCATGGAATTCTGAGA
GTATAAAGTTACGGGATTACCAGGAGGACTGCGTTCGAGCTATTCTGACG
AGTATGAATGAGGGTGAGCGAAGAATGGCAATTTCACTGGCTACTGGTGG
GGGGAAAACAGTATTCCCCCCTTCTCTTATTCTCCTTCCCCCAAACGAGT
GATAAACTCACAAGATCAATGTGTGCTACTTGTGGTGATAGGTCATCTTC
ACAGAGCTAATATCCCGCCTAACTCACCCCGCGCGCCCAGAAGCCGAAAA
AACACTCATTTTAGTACACCGCCGGGAACTTGTCCACCAGGCAGCGAAGC
AGTGCGAAAAGCAGTATCC

Sequences in the Contig:

SY0AAB41YI22FM1