Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YI11FM1
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00007501001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: importin beta-3 subunit
Accession: ref|XP_750428.1| Score: 332 E_value: 1e-29
KEGG Definition: importin beta-3 subunit, putative
Accession: afm:AFUA_1G06790 Score: 332 E_value: 7e-30
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2171 Score: 253 E_value: 6e-23
PFAM Definition: No Hit Found
Swissprot: O74476|IMB3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005635 = Cellular component: nuclear envelope
GO:0005525 = Molecular function: GTP binding
GO:0008565 = Molecular function: protein transporter activity
GO:0006606 = Biological process: protein import into nucleus
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>SY0AAB41YI11FM1
TTGGCTTCGCGCATCTGGTTTCGTTTAAGGATATAGACCGTTTGGTTCTC
TGCTCCTCTTTTTTTTCACCTTTTTCCTTTAAAAACTCTTTCCTTTCTCC
AGTACGTCGTTCCGCCTCTACGTGTGCCATGTCCCAACTGCCCCACGGTG
TCGTGGAGAGCCTCCAGCAACTCCTCTTGGGCTTGGAGTCCAGCGATAAT
AGCATTCGAAGCGAGGCCGAGAAGAGCTTGAATAATGATTGGATTCTGGC
AAGGCCCGATTTGCTACTTTCTGGTCTCGCGGAACAGGTGCGGGGGGCGG
ATAATCCTGCTAAACGTTCCTTTGCTGCCGTCTTGTTCCGGCGGATGGCC
AGCAAATCATCAACAAAGGATAATCAGCCTAGTGAATTGTTCCTATCATT
GGCCCCCGAAATTAAAATCTACATTAGGAATGTTTTGCTTGGTTGCTTTT
CGGAGGAAACGGACAAGGCCGCCAGAAACAAGACTGGCGACGCCGTAGCT
GAGGTGGCTAGACAGCTGAGTGATGCGGAAGAATCATGGCCGGAACTTTT
ACATGCTCTTTTCCTGGCTAGCAAGCATCTAGATCCTAG

Sequences in the Contig:

SY0AAB41YI11FM1