Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YG23FM1
Length(NT) : 428
Best Gene Model Blast : Link to GSTUMT00012219001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Nascent polypeptide-associated complex subunit beta (NAC-beta) (Beta-NAC)
Accession: sp|Q0ULD0|NACB_PHANO Score: 581 E_value: 1e-58
KEGG Definition: hypothetical protein
Accession: ang:An12g07790 Score: 559 E_value: 2e-56
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2240 Score: 439 E_value: 8e-45
PFAM Definition: NAC, NAC domain..
Pfam Number: pfam01849 Score: 201 E_value: 4e-17
Swissprot: Q0ULD0|NACB_PHANO

Sequence:
>SY0AAB41YG23FM1
TTGGAGCAAAGCTCGCTAGGCTTCAGGCGTCTGTTAGAATCGGTGGGAAG
GGCACACCCAGGAGAAAGGTCAAGAAGGTCCACAAGAACGCCGGTACCGA
TGACAAGAAACTTCAGACTTCTCTCAAGAAGTTGAATGTTCAGCCCATCC
AGGCCATTGAGGAAGTCAACATGTTCAAAGAGGACGGAAATGTTATCCAC
TTTGCTGCACCAAAAGTGCACGCCTCGGTTCCGGCTAACACTTTCGCCAT
CTACGGCAATGGTGAAGATAAGGAACTCACCGAGCTCGTTCCTGGCATCC
TTAACCAGCTTGGTCCCGACTCTCTTGCATCTTTGAGGAAATTGGCCGAG
AGCTACCAGTCGCTCCAGAAGAAGGAGGGTGAGGAGGGCGAAAAGAAGGA
AGGTGATTCCGACGACGACGACGACGAC

Sequences in the Contig:

SY0AAB41YG23FM1