Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YG03FM1
Length(NT) : 524
Best Gene Model Blast : Link to GSTUMT00006406001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: 60S ribosomal protein L32
Accession: ref|XP_001595262.1| Score: 586 E_value: 4e-59
KEGG Definition: 60S ribosomal protein L32; K02912 large subunit ribosomal protein L32e
Accession: aor:AO090102000226 Score: 561 E_value: 1e-56
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0878 Score: 493 E_value: 7e-51
PFAM Definition: Ribosomal_L32e, Ribosomal protein L32. This family includes ribosomal protein L32 from eukaryotes and archaebacteria..
Pfam Number: pfam01655 Score: 444 E_value: 4e-45
Swissprot: Q7RXY1|RL32_NEUCR

Sequence:
>SY0AAB41YG03FM1
TTGGCTTTTTCCACCAACCTCCGATTTTTCGACAAGATGACCGCTGCCAA
AAAGCATATCCCGATCGTCAAGAAGCGGACCAAGAGGTTCAATCGCCACC
AAAGCGACCGCTACAAGACAGTCAAGGCGGCATGGAGGAAACCCAAAGGT
ATCGATAACAGAGTTAGAAGGCGCTTCAAGGGACAGGCCGTCATGCCCTC
GATCGGTTTTGGATCTAACAAGAAGACCCGCCACATGATGCCTTCTGGGC
ACAAGGCATTCCTTGTCCAGAACACCTCCGACCTCGACCTCCTTCTCATG
CACAACAAGACATATGCTGCCGAGATCGGCCACGCTGTTTCATCCCGGAA
GCGTATCGAGATCATTGCCAAGGCTAGGACATTGGGCGTCAAGGTCACCA
ATCCTAAGGGAAGGGTTACGACCGATGCTTAAATGGGTTGTTCTGGAGTT
TTTTTTTCTTCTTTTCCCTTTCCCCTTTCCTTTTTGTTATCATACAGGGA
ATTCAAAAAAGAAAGGGGAAAGGG

Sequences in the Contig:

SY0AAB41YG03FM1