Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YF15FM1
Length(NT) : 529
Best Gene Model Blast : Link to GSTUMT00010985001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_13049
Accession: ref|XP_001585957.1| Score: 385 E_value: 7e-36
KEGG Definition: hypothetical protein
Accession: ani:AN2481.2 Score: 370 E_value: 2e-34
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2968 Score: 200 E_value: 7e-17
PFAM Definition: No Hit Found
Swissprot: Q0CNC7|NTE1_ASPTN
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0004622 = Molecular function: lysophospholipase activity

Sequence:
>SY0AAB41YF15FM1
CGAAGACGAGAGTGGTCCTGTGAGTACTAGTAGTAGTATGGTGAATCTTC
ACGCTGCCGGGGACTTGGCCCACTTTGAGGCCGAAAGGAACCCCGCAGGA
TTGCCGCCCGGAAGGAGCGCAGATAGTGGACGATTTCATTTGCCTCCCGT
GCCTCCGCTATCCTTGAGTGGCGACTTTACCCGAAGTAGTTCGCGGCCAG
TGACGCCGCATGATCAACAACCCCCGCGTCCCCAGAGACCTCGAATAAAA
AAATCCAAGTCCGTACACCCAGATATTGTCGCTAGAGCGACCGTTGACAC
CACAATTGCGGTTATCCCCGCTAGCGCATTTCGAAGGTTGACTAGGATTT
ACCCTAAAGCGACGGCACACATCGTTCAGGTTATTCTCACGAGGTTTCAG
AGGGTCACATTTTTGACTGGTTACAGGTATCTCGGCCTTACGGCTGAGGT
TCTGAGGACTGAGAAGTTCATGAATAGATACACTATGTATGAACTGCCGA
ATCATCTCCGCGGGGAGCCCCTTGAAAGA

Sequences in the Contig:

SY0AAB41YF15FM1