Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YE22FM1
Length(NT) : 635
Best Gene Model Blast : Link to GSTUMT00011023001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: phenylacetyl-CoA ligase, putative
Accession: ref|XP_001260500.1| Score: 492 E_value: 5e-48
KEGG Definition: phenylacetyl-CoA ligase, putative [EC:6.2.-.-]
Accession: afm:AFUA_2G10160 Score: 490 E_value: 4e-48
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1176 Score: 176 E_value: 6e-14
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 155 E_value: 2e-11
Swissprot: Q9M0X9|4CLL7_ARATH
Gene Ontology:
GO:0005777 = Cellular component: peroxisome
GO:0004321 = Molecular function: fatty-acyl-CoA synthase activity
GO:0009695 = Biological process: jasmonic acid biosynthetic process

Sequence:
>SY0AAB41YE22FM1
TTGGCGACAAGAAAGTCCCCCCAACCCACACCCACGAGCGTGCAGCTCTA
CTAGTAGTCTTTCCGCAGCTGATCTTACCTTTTCTCCGCAGCTCCTCTAC
GCTGCTCCTCTCCTACCCAACTCGTGTTGCCCCTCATCCCGCAATACCAG
TGGTGATCTCTAGAAACGCCAAATTGCACTTCCACTACCTTCCGAAATGC
CTATCGCATCGCCCTTTCCCACCATTGATATCCCCCAAAAGGATATATAT
TCGTTCTTGTTCGAAAGAGAGGATAGACCTTTCCCAGAAGACCAAGTCGT
TTACATCGATGGGAATACCAAGCGCCAATTAACCTATGCAGACGTTCGAG
ACCAAACACAGACTTTCGGAATCGGTCTCAAGTCTCAGTGGAGTTGGCGA
AAAGGTGACGTTTTGGCAGTCTTCAGCACGAACCAAATCGACACACCACC
GATAATATGGGGAACTCTGTGGGCCGGCGGCGTTATTACGACGGCGAATC
CGAGCTATGGGGTGGAGGAACTTTCTTTTCAACTGAAGGACTCGCGTGCG
AAGGCTCTGGTGACGTTGGTTGATTTGCTCCCGATTGCCGTACAGGCAGC
CGCAAATGCGGGAATTTCAAAGGACCGGATCATCG

Sequences in the Contig:

SY0AAB41YE22FM1