Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YD17FM1
Length(NT) : 545
Best Gene Model Blast : Link to GSTUMT00001665001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05802
Accession: ref|XP_001592880.1| Score: 313 E_value: 2e-27
KEGG Definition: hypothetical protein
Accession: fgr:FG00281.1 Score: 270 E_value: 9e-23
KOG Definition:
Classification: [Energy production and conversion, Replication, recombination and repair].
Kog Number: KOG3194 Score: 272 E_value: 3e-25
PFAM Definition: Rad1, Repair protein Rad1/Rec1/Rad17..
Pfam Number: pfam02144 Score: 264 E_value: 3e-24
Swissprot: P22193|RAD1_SCHPO
Gene Ontology:
GO:0030896 = Cellular component: checkpoint clamp complex
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0006281 = Biological process: DNA repair
GO:0000076 = Biological process: DNA replication checkpoint
GO:0031573 = Biological process: intra-S DNA damage checkpoint

Sequence:
>SY0AAB41YD17FM1
TTGGGGTCCTTTATGCTTGATCTTGGAAGAACCCCCGATAACAACCACTT
GCGAACTGACAACCTACACCCCAGCCCCCCTCCCTGACATCCCCCTCTCC
CCTACCCTAACTCGGAAAATCATCCTAAAATCATCCCTCCTCCACGACGC
CATCACCGAACTCTCCTCGTCCCCCGTCCTCCCTTCTTCCTCTTCCCTCC
TAGTAATCTTCACATCCCCATCACCGCCCCACTTCGCCCTCTCCTCCACC
TCCCCGCTCGGCACCACAACAGTCCAATTTAGCAACGACGGAGACCTCCT
GGAAACCTTCATGGTGAGCGGACGCGCAAAGGACGTGTACCGCTTCGACC
TCGTTAGGCACGCGCGCGGAGCCATGGCGGTCGCGACAAAAGTTAGCGTC
CGGAGCGACGAGGCGGGTGTACTCAGTTTGCAGTTTATGGTGGAGTGGGA
GGGGCGCGCGAGTTTTGTGGACTTTAGGTTTTTGGGGGTGGATGATGGGG
AGGGTGGTGGTGGTAATGGCGAGAGTGAGGGGGATAGTGAATAGT

Sequences in the Contig:

SY0AAB41YD17FM1