Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YA11FM1
Length(NT) : 654
Best Gene Model Blast : Link to GSTUMT00005113001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61872.1| Score: 301 E_value: 7e-26
KEGG Definition: tuberin - Rap/ran-GTPase-activating protein
Accession: aor:AO090701000123 Score: 301 E_value: 3e-26
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Signal transduction mechanisms].
Kog Number: KOG3687 Score: 200 E_value: 9e-17
PFAM Definition: No Hit Found
Swissprot: Q9UUG9|TSC2_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0033596 = Cellular component: TSC1-TSC2 complex
GO:0005515 = Molecular function: protein binding
GO:0006995 = Biological process: cellular response to nitrogen starvation
GO:0006886 = Biological process: intracellular protein transport
GO:0043091 = Biological process: L-arginine import
GO:0009935 = Biological process: nutrient import
GO:0043087 = Biological process: regulation of GTPase activity
GO:0031929 = Biological process: TOR signaling pathway

Sequence:
>SY0AAB41YA11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCTGGAGGTTTGGAACGAT
ACCCAGTCAGTTCAACCTCGTTAGCATAATCATCACGCCCGAGGCGCGCT
CAGGGTTTGTGTCATCGCGTTTGCTGAGGAAGGGGTCTGGAGATAGGACA
TTTTATAGGGTTCAGATGGTGTGCAAGGAAGGGTTTTCGGAAATTAGTCC
CGCTCAGGAGCCTAAAATCGTCTCGGAATCATCACTCCCGGCGTTCGTTC
GTAATCTCGCACTCAACGCAAGTGTCTATTCATACGTCTACAATGAAGGC
GGCGGAGAACATATCTCCAACTGGAGGCATCGTCTAAGGAGCATCGCCAA
ATTGAGAGAACGGACCTCCGCCGCGTCCCCGGGATTGGGCGGAAACGGTG
GACCAATCGGCAGCGGTGGCGGCGGAACAACGAGCCCCGGGCAGAACTCG
ACTGCTCCAGGGTCAAGGCGTGTTTCGACGATGAGTGCACAGACTTCGGT
GTCGGATCATAGCTATAGAAATTCGGCCCATATGAATGGTGACACAGATC
AATCTGAAACAGAGGATCTGTTAATGAGCCTTGACTTTAGCAGATTCACT
TAGCGCAACCCCAGCTCCTTGTTCTGCTCCATTCTCATTCTCCATTCCCT
CTCT

Sequences in the Contig:

SY0AAB41YA11FM1