Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB41YA10FM1
Length(NT) : 614
Best Gene Model Blast : Link to GSTUMT00003173001 E-value : 1e-158
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12282
Accession: ref|XP_001549296.1| Score: 429 E_value: 9e-41
KEGG Definition: hypothetical protein [EC:2.7.11.17]; K07359 calcium/calmodulin-dependent protein kinase kinase
Accession: ani:AN5728.2 Score: 404 E_value: 3e-38
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0585 Score: 376 E_value: 4e-37
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 196 E_value: 2e-16
Swissprot: P50526|SSP1_SCHPO
Gene Ontology:
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0030428 = Cellular component: cell septum
GO:0005829 = Cellular component: cytosol
GO:0030042 = Biological process: actin filament depolymerization
GO:0051519 = Biological process: activation of bipolar cell growth
GO:0030950 = Biological process: establishment and/or maintenance of actin cytoskeleton polarity
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0008104 = Biological process: protein localization
GO:0006950 = Biological process: response to stress
GO:0007165 = Biological process: signal transduction

Sequence:
>SY0AAB41YA10FM1
TTGGGATTATGAGGATGGTTGTGATGGCGAGGAGGCTACTGGGCTTGAGC
AGAACGAGTTGGAATTAGCCAAAACAGCTGGCACTCCAGCGTTTTTTGCA
CCCGAGCTTTGTCATGTCGATCACAACCAGCCACGACCTCAAATCACTAG
TGCAATTGATGTCTGGGCTCTCGGTGTCACGCTTTACTGCCTTGTCTTCG
CTCGCTGCCCCTTCATGGCAGACAACGAATACCAGCTTCTTAGAGTCATT
GCGAAGGACGAGCTCGTGATTCCTAACCGTCGAGTTCGCCCCGTCAAAGC
CGTCAATTCTTCTAGGCCGGTTAGTGCTCCCCCGACGGCTGAAGAGCTGC
TCGAAATGGAGACGGAGCCGATTGACGTTGATCTCAAAGACTTGCTCAAA
CGGCTCCTTACAAAAGACCCAACCAGAAGGATAACTTTGAGAGAGGTTAA
GCGACATCCGTGGGTTCTCCACGGCATCGCTGATCCTTGTGCCTGGGTTG
ACGAAACGGATCCGGAGAGAATGTCTGACGGCAACAGGATCGAGGTTACC
GTGGAAGACGTGGAGAAGGCTGTTTCTAGTGCTGGTGTGTTGAACCGGGC
TAGAAGCGCTGTCA

Sequences in the Contig:

SY0AAB41YA10FM1