Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YP02FM1
Length(NT) : 644
Best Gene Model Blast : Link to GSTUMT00004681001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: RNAse P Rpr2/Rpp21 subunit domain protein
Accession: ref|XP_001257454.1| Score: 222 E_value: 1e-16
KEGG Definition: hypothetical protein
Accession: ang:An12g08040 Score: 209 E_value: 2e-15
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4394 Score: 220 E_value: 4e-19
PFAM Definition: Rpr2, RNAse P Rpr2/Rpp21/SNM1 subunit domain. This family contains a ribonuclease P subunit of humans and yeast. Other members of the family include the probable archaeal homologues. This family includes SNM1. It is a subunit of RNase MRP (mitochondrial RNA processing), a ribonucleoprotein endoribonuclease that has roles in both mitochondrial DNA replication and nuclear 5.8S rRNA processing. SNM1 is an RNA binding protein that binds the MRP RNA specifically. This subunit possibly binds the precursor tRNA..
Pfam Number: pfam04032 Score: 252 E_value: 8e-23
Swissprot: Q9Y813|RPR2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB40YP02FM1
TTGGGTCTCTCCTTCCACTCGAATACCCTATGATATCATAGAAACGGAAA
TCTAAATTAAGCGCAAGCGACAGCGATTACACGCAAACATCCACGGGCCA
ACCTCCTCGCTCCCAGTCCAGTAATTGCCAACCTCACACATCCTCATCAA
ACATCACACAAAACTCCACCAAGCGCGTCCCCACACACCTAACCCAATGG
CCCACAAAAAACCAGCCAACTCCGCACAAGCCCCCCCGCGCCCCCACCTC
TTCGCCCGCCTAAACTACCTCCACCAATCCGCGCATCTCCTGCTCACCTC
CGGCTCCCCGAACCTCTCGAGAAACCTGGTCTCCACGGCGCGCACGGTTG
CGAAGAAGACAGTTATCAGGTTCGACCCATCGGTGAAGCGCACTTGGTGC
AAGCGCTGCGACGCGGTGCTCGTGCCCGGCGTGAGCTGCGAGCACAGGGC
GGAGAATCTGAGTAGGGGCGGGAGGAAGGCGTGGGCGGATGTGCTGGTTG
TTAGGTGCTGGGGGTGTGGGTGTTTGAAGAGGTTTCCCGTCGGGAGGGGG
GGAAGAAGGGGCGAGAGCGGGGGGAATGGAGAAGGTGGGAAGGCGCGGGA
GGGGGAATGCAATGTTGCGGGGGAGGGGAAGGGAAAGGGAAAGA

Sequences in the Contig:

SY0AAB40YP02FM1