Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YO13FM1
Length(NT) : 402
Best Gene Model Blast : Link to GSTUMT00010494001 E-value : 1e-179
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56541.1| Score: 388 E_value: 2e-36
KEGG Definition: WD40 repeat
Accession: aor:AO090005001641 Score: 388 E_value: 1e-36
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0313 Score: 145 E_value: 1e-10
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 124 E_value: 3e-08
Swissprot: Q09150|REC14_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0007131 = Biological process: meiotic recombination

Sequence:
>SY0AAB40YO13FM1
TTGGGCAGGCGACTCCAATATAATTGCATTGTACGATGTGATATCTGGGG
AGCAAGTTGGGAATCTGTCCGGTCATAGTAGCTGGATCTTTTCGGTTTCT
TGGAGCAAAACTGGCGAATATATTCTCAGTGGTGCTTTTGACGGAAAAGT
CAAAGTCTGGTCGACCGATACGAAGACCTGTGTTGCAACCCACACGGAGA
ACGATAAAGCTCTGTACGGGGTAAAATGGATTCCCAAATCCTCCGGTATA
GGCGAAGGATTTCTCACAGCTGGAGCGAACGGGAAGTTATGTTTTTACCG
CGAAGCAACAGGCAGCTGAAGATACTCTCCGAACTCGATCCTTAGCTAGT
ATACCAGAACAGAAGTAAAAATAATAATAATAATAAACTTAATCAAAAAT
CC

Sequences in the Contig:

SY0AAB40YO13FM1