Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YO11FM1
Length(NT) : 730
Best Gene Model Blast : Link to GSTUMT00007140001 E-value : 1e-134
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 151 E_value: 2e-08
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 151 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB40YO11FM1
TTGGATCCATAACCCACTTTTCATTGGAGGACTTCCCGTGAGTCTATCGG
GGTCGAGGTCTATTGGAATAGAGAGCTGAATAGAATGTCTGACTTCCCGT
AGACAGCAGGATTGCAGCCAGTTCCCTCACTTGCTGCATTGGGAATAAAC
TAAAGCACTAGTGCAATAACTGGATTTCTTGTTAGGTAGAGTTGCATCAT
ATATCCATATTGGGAGAGGTGGTATCTTGTTAGTCACCCCCCTTCTATTC
ACTACTTTTACACACCCTCTCCTATTTTACAATATTCGGAAATTCCTGTT
CTATCCAGGCGATAGGCTTACGGGAAGTCATCCATTATTCCAAGTTGCAG
AAACGAGAACATGGCTCATTATCTCAGCAACAACACTAATTGTCTCAACA
CTAACAATTTTGTTAATATATCGAATCACTATACCGTCCCCGATCAGCAA
CGTGAAGTCCTACGATAGCTATCTCCACTTGAGCCCCGTATGCGCCACCA
GGACATTCAAGCCCTGAGGGCCGAAAATGTGGGGGATTGGCTCTTTGAAA
CCGGCGAATTTCGACGTTGGAGGGAGACTAGTGGGGAGGCCAACTGTGAA
AATGCTGCCATGTTTTGCTACGGTGATCCGGGAGTGGGCAAGATCTACCT
TAGCTCGCTGGTAATCGACAGGTTAGGTGATGAGGCCAGAGGGAGATCTG
ATATTGTTGCTTGCTTCTATTTTGATTTCG

Sequences in the Contig:

SY0AAB40YO11FM1