Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YM15FM1
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00012088001 E-value : 1e-102
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG10048.1
Accession: ref|XP_390224.1| Score: 266 E_value: 7e-44
KEGG Definition: hypothetical protein
Accession: fgr:FG10048.1 Score: 266 E_value: 4e-44
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3771 Score: 192 E_value: 7e-16
PFAM Definition: BAR, BAR domain. BAR domains are dimerisation, lipid binding and curvature sensing modules found in many different protein families. A BAR domain with an additional N-terminal amphipathic helix (an N-BAR) can drive membrane curvature. These N-BAR domains are found in amphiphysin, endophilin, BRAP and Nadrin. BAR domains are also frequently found alongside domains that determine lipid specificity, like pfam00169 and pfam00787 domains in beta centaurins and sorting nexins respectively..
Pfam Number: pfam03114 Score: 151 E_value: 5e-11
Swissprot: P39743|RV167_YEAST
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0008092 = Molecular function: cytoskeletal protein binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0006897 = Biological process: endocytosis
GO:0006970 = Biological process: response to osmotic stress

Sequence:
>SY0AAB40YM15FM1
TTGGTTTCGTCATCCCCCCCTCCAATCTCGCCTCCTCCGGCCCTGGAATT
CGTTTCTACAAAGAAAGAAAAAAAATCGCCGGATAGCCAGATCTCCGCTT
TCTCTCGCCCCCCACTCTCAACCCTACTCTTCCTCCCTACCCACCCCCCA
AAACGACCGATTTACAAACCCCGAGTACCATACACCCCGACTACTTCCTC
TGTCATTACTCCTTCCTTTGCAACCCATTGTTCGCGACCACCATTTGCCC
GCCATGAGTTGGAAAGGGTTTCAGCGGAGTGTCGTTCGGGCGCCGCAATC
GATTAAACAGAAATTCAATATGGGTGAAGTTACGAAAGATGCGATCTACC
TAGATGCAGAGAGACAATTCGATGAGCTAGAAAAGGAAACGAAGAAGCTC
CATGATGAATCGAAAAAGTATTTTGATGCTATTAATGGTATGCAATAGAT
AACCTACCAAGTTTAGCTAAATGGGTTACTAATGAGCCTTAGGCATGCTG
GATCACCAAATCGAATTCTCAAAGTCCATTGCTGAAATATACAAACCGAT
CTCTGGCCGAGTGTCGGATCCGGATTCGATCAAGATTGAGGGAAACCCTG
AGGGTATCCGGGCTTGCGAGGAGTATGAAGCTATCGTCAACGACCTCAAG
GT

Sequences in the Contig:

SY0AAB40YM15FM1