Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YK10FM1
Length(NT) : 643
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: translation initiation factor IF3
Accession: ref|XP_752584.1| Score: 109 E_value: 2e-08
KEGG Definition: translation initiation factor IF3, putative; K02520 translation initiation factor IF-3
Accession: afm:AFUA_1G12160 Score: 109 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB40YK10FM1
TTGGGGCAACTCCTCTGCCGCCGAACTCACCAACAGAGGCTCCAATTCCT
CCTCCCCCGAAAACAATTCTCAACAGCACTCCCGAGATTATCCTTGCCGC
AAGAGTCTCCGGAGCTCCAAGACAACCAGCAGACCCTACCGCGGCCGGAA
AACAAGGAAAACCAAACCACCAACACTAAATCGACCTCTGCCTCAGAACC
GTCCCTAGACCTCTCGCACATCCCGAAAAACGTCAAACTCCGCAACGAGG
ACATCATCCCACTGAACGGTGAGATCCGCTACGTGGATGCCAACCTGTCA
CACCATGGCATCGTCAAATTCGCCCACGTGATCAACTCCTTTGACAGGCA
CGAGTATGCTCTCATATGCGTGAACCCCAGTGTCATCTCCCGGGATGAGC
CGCCGACGTGCCTGCTCACGCCCATCGCTCACATACTGGAGAAGGAACGC
CTCGAGGCCGAAGCGGCCGAAGCGCTCCCCAAGAAGCCCGCTATCCCCAC
CAAGGTGGTTGGAGTTCACGTGGGCGATTTCGGTGAACGACCTCGCGCAT
AAGATGAAGAAGATGGGGGAGTTTTTGCGGAAGGGGAATCGGGTTGAGGT
TATTATTGGTGTGAGGAAAGGGGCGACGAAGGTTAGTGCTGAC

Sequences in the Contig:

SY0AAB40YK10FM1