Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YJ24FM1
Length(NT) : 602
Best Gene Model Blast : Link to GSTUMT00003288001 E-value : 1e-150
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR02760.1| Score: 267 E_value: 1e-34
KEGG Definition: MMS2; Ubiquitin-conjugating enzyme variant MMS2 (UEV MMS2)
Accession: pic:PICST_34709 Score: 219 E_value: 3e-26
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0896 Score: 288 E_value: 6e-27
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 140 E_value: 9e-10
Swissprot: O74983|MMS2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0042803 = Molecular function: protein homodimerization activity
GO:0006301 = Biological process: postreplication repair
GO:0016567 = Biological process: protein ubiquitination

Sequence:
>SY0AAB40YJ24FM1
TTGGCACCTTATTCCTGACTTTGGACAACACCAGGCAATTTGCCATTTGC
TTTTCAAGGGAACTCATCCTAACGAAAAACCGCCTCCCGAAACTTTACCA
ACTCTTTTAGTTAAGATGGTCGCTAAAGTTCCTAGGAACTTTCGCTTGCT
CGAAGAGCTAGAGAAGGGCGAGAAAGGGTTGGGTGCTGATGGTTGCTCTT
ATGGTCTACAGGATGGAGACGACGTGATGATGTCTAACTGGAATGCTACC
ATTCTGGGACCTCCCCACGTGAGGTTCCTCGGCGCGCGTCATCAACAGCA
AGCTTACTCAAAAATTCACAGAGCACCCACGAGAACCGCATTTACAGTTT
GAAAATACACTGTGGAGATTCCTACCCAGACGAACCCCCGGTGGTCCACT
TTATATCTAAAATCAATCTTCCCGGTGTTGATCCTAATAATGGCAAGGTC
GACCTACTCAAACTGGGTCGTGTGAGCCAATGGAACAGGGATAACACTAT
GGAGAAAATCCTTGTGGCTTTGAGGGAACACATGGCCAGCCCGAATAACA
GAAAGGTCCATCAGCCCCCCGAAGGTACTACCTTTTAATTTTCGGTAAGC
GA

Sequences in the Contig:

SY0AAB40YJ24FM1