Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YH21FM1
Length(NT) : 563
Best Gene Model Blast : Link to GSTUMT00006968001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0307 Score: 123 E_value: 7e-08
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 112 E_value: 1e-06

Sequence:
>SY0AAB40YH21FM1
TTGGCAACCCGCAGCCATCCAAATTACAGTCTACGGATAGACCACACTCT
CCAAAGGCCCCTGGCCAACCCTCGTACACCGGCTATCATTACCAACCCCA
ATCAAGGCCTCTATCGGCCGGTACGAATTCTAACCAACCGTACCCAGAGT
CCAGTGGGCCGCCGTCCGTATACCCAAGCCAGCCATACCCGTCTCTTACC
CCTCAGTCCACTACTCCAGGAGGAACTAGCAACCCTTCGACGCCGTACAA
TACCTATAGCTCCCCTGCAGTCGGTGCTCCACCCCAACCGAACAACAATG
AACTATTCCTACCACCGGGAAGCAGGGCTCAGAGTTAGTTGGTTGGATCG
TCCAGTATTTATCTGGTCGATTAGTTAGTTAGTCGTCTAGTTTTACCGTG
TTCCAATTAGTCTGTAATATCGGCGTTCGTGCGCTGTCTGTCTGTCTGTC
TGTCTTGTCTGTCTCTTCTGTTTGAAAAGAACTGGAACTGGGAGTGATTA
CTTTGTAGTAGCCGCAGGGATTGGCTTTGACTGGATTGATGGGATGGCAT
ATGGTAGGCGAAT

Sequences in the Contig:

SY0AAB40YH21FM1