Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YF16FM1
Length(NT) : 662
Best Gene Model Blast : Link to GSTUMT00001670001 E-value : 1e-157
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12954
Accession: ref|XP_001548559.1| Score: 256 E_value: 1e-20
KEGG Definition: RRM domain
Accession: aor:AO090038000602 Score: 249 E_value: 4e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O60176|YG41_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB40YF16FM1
TTGGCCATCCACAATCATCCCACCATCGCACACCCCCCTCAATCATCAAA
TTGCCCGCCACTTTCTCGTCTTTCGTTGTTGACGGTTTGATTATCTGTCG
ACACCCTTACTTAAGAGCGATTTTTCTTGCCACATCCCTTGCGTCAATCA
CGACGGTGCAATTTTTCTGCAGTTGTACTTTTCTCGAGCCGGTTAACTCA
AACGAAGCAGGTTTCGAAAATAATATCCTTTATTGCCTCCCTTTTTTCTT
TTAAAAAGCGATCTCTTTTTTTTTTTGGCGCCAGAGCCAGAAGTTTCCTC
GATCCGACCTCAACAGAAAACAACCGGCCCATCGCATCGTTTTTACGCTT
TTTTTCTGTCTTTTTCAAGGTTGAACGAACAACATGTCATTTCAATACGA
TTACCCGCAGCAGCAGCAACAGCAAGGCTCTGCCTCGCCAACTGGTGCCT
CCGCTGGCGGGCCACCTCCTACTGCAGGCTCTTCTAATGGTGCTGCTGGT
AGCGATGCTAAGACGACTTTGTGGATGGGTGAGCTCGAACCGTGGATTGA
TGAGGCGTTTGTTAGAAATGTTTGGTATCAATTGGGCGAAGGAGTTAATG
TTAAGATGATTCGCGACAAGTTTTCTGGTAATGCTGGTTATTGTTTTGTT
GATTTCAGCAGT

Sequences in the Contig:

SY0AAB40YF16FM1