Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YE10FM1
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00004159001 E-value : 3e-73
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 142 E_value: 2e-07
KEGG Definition: hypothetical protein
Accession: ani:AN8541.2 Score: 138 E_value: 3e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB40YE10FM1
TTGGGAACGATTTTCATGTCTATTAAGCTTCTTACCAGAATTTTTCCCCC
TTCTATTATTGTATACGAAATATCTCGGATTCTTTTCTATATTCTGCCAC
AGCCGATTATATTTCCGGTTCAAGTGAAAGACTATCGCAAAGGCCGGAAA
TAAGCTGGGGGGAAAGCAGAGCAGTACAGTACGGGCCAGACAGTAGGTGT
ACGAACTGAGTAAGTGCGGCTCTTGCACTGCGATTAAGCTTAGGTCCCCC
GCTGGTGTTCTCGGGAACAATGCCTAAAACTGATGTTTTATAGTACCCAA
CGCCAGAGCTCTAACAACAATAATTCCCGATCGTGCGCGGGGCCTACTCA
AGTATTCCAGAGGGACGAGCCAACAGTGATCGGCGAGGAAATCCGCTTTC
GGAACGACCGCAACGGCAGGTTCAGCCCAAGCCGGGAGTTTAGTTCACTC
ATTTCAGTAGGGGAGGAATCTTGGGTCACAAATCAGCATATCCAAATAAT
AGGTCAGTAGAGGTACTGCGGAATAGAAATTATGCGTCGGTCTATGTGGG
CAGGTATACAGAAAATACAGGGTCCAAATCACCCGAATAGCTTACGGAGC
ATCAATAAGAAGGGCACGGCACTGTATTACGAGGGAAAGTACGATGAAGC
CGAGATTATGCATCGGCGTGCATCGGCGGGCAGGGAG

Sequences in the Contig:

SY0AAB40YE10FM1