Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YE06FM1
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00004978001 E-value : 1e-149
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An04g01480
Accession: ref|XP_001401514.1| Score: 147 E_value: 5e-08
KEGG Definition: hypothetical protein
Accession: ang:An04g01480 Score: 147 E_value: 2e-08
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1716 Score: 188 E_value: 2e-15
PFAM Definition: DSPc, Dual specificity phosphatase, catalytic domain. Ser/Thr and Tyr protein phosphatases. The enzyme's tertiary fold is highly similar to that of tyrosine-specific phosphatases, except for a "recognition" region..
Pfam Number: pfam00782 Score: 177 E_value: 5e-14
Swissprot: P0C593|DUPD1_MONDO

Sequence:
>SY0AAB40YE06FM1
TTGGCTCTGTTCTGCTCGGTCTATCGAATCCTATAGGACCATCTATCCTT
CTATCCATATACGAAGCAATCGACCAACCTCGCAATCAGGCCGCGAAGCT
ATTATCAAGGCTAGCATACCAATCAAAGCAACAATGTCTATCGAAACCCA
GCAACTCCACCGCGCTCTAATCACAAAAGACCGTACGCTGCCATGCGCCA
GATATCGGAGCATGAATGAAATCCTCCCAACCCTCTACCTTGGCGAGTCC
GTTTCCCCCTTCCCCCTTGCCCCGTTTCCTCGCCAACTCTACTAACACCC
CCACAGCTGTAAGGCAATCCTCGACCCAATAACCCTCCTATCCTCCGGCG
TAACGCACGTCCTCTCACTACGGCAGTCGCCCGTGTACATGCGCCACCAA
GTGAATGTAAAGCACTGCCAAATCTTCATTGATGATACGGAAGACACCTG
GCTGCTCGACTCACTCAATGCCGCAATGGATTATATCGAGCGCGCCATGG
AAAGCGGTGGAGTCGTGCTTGTGCACTGCCAGGAGGGGAGGAGCCGGAGC
GCTAGCGTTGTCATTGCTTTTCGTGAGTCTTTTTCTTTTGTCCCATTTTT
TTCTTTCGGAAGTGGTTGAGAGAGTGTGGCAGCTAATAT

Sequences in the Contig:

SY0AAB40YE06FM1