Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YB08FM1
Length(NT) : 676
Best Gene Model Blast : Link to GSTUMT00002256001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_07194
Accession: ref|XP_367269.1| Score: 164 E_value: 6e-20
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07194 Score: 164 E_value: 3e-20
KOG Definition: No Hit Found
PFAM Definition: DUF2012, Protein of unknown function (DUF2012). This is a eukaryotic family of uncharacterised proteins..
Pfam Number: pfam09430 Score: 237 E_value: 5e-21
Swissprot: Q8VY97|Y4213_ARATH
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAB40YB08FM1
TTGGCCAACAACCAGCAACAAACAACAAACCTCCACCGAAAGAGTCCATC
ATGAAATTCCTCGCGCTCCTACCGTTTCTGTCAGCCATCGTCTCGGCCTT
AGATGTTCAGGGCACCTTTGCACCATCTCCTCTCCTACCCAATCCGTCCA
CCCTTCCGCCCTCAACCTCGCTCACACTCACCACCACCGGAACTACAAAG
CGAACCCTAATACGGCGTGATAATACCTTCAGCTTTCGTGATGTGCCCGA
GGGGTCATATCTGCTCGATGTGCAATGCCAGACTCATCAGTTTGCGCCTT
TACGGGTAGACGTCAACGGGCAAGGGGAAGTGGTCGTGCACCAGACTTTC
CGCGGCAATGAATGGAGGAATAAGGGAGAAAGGAAGAGTTATCCCATAGT
TCGTCGACCTCTAATCATCCTGTTCATGCCTCATCTGCAGTTTGAATCAT
GGCTAAACTGAGTTTCTTTGTTTTTCCGAAAAGGAAATCCAACCAGTTCG
TCCTATTGACTACTACGTCGTTCGTGAAAGCTTCAATCCTACCAAGCTCC
TCGGATCACCAATGGTTCTCATCGCCCTCTTCACTCTAGTCATGATCGTC
ATGTTGCCCAAACTCATGGACCAAATGGACCCAGAATTCAAGGCGGAGCT
AGAAGCACAGCAGCGCAAAGGCGGCG

Sequences in the Contig:

SY0AAB40YB08FM1