Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB40YA21FM1
Length(NT) : 541
Best Gene Model Blast : Link to GSTUMT00003973001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_05861
Accession: ref|XP_001555586.1| Score: 230 E_value: 7e-18
KEGG Definition: hypothetical protein [EC:1.1.1.100]; K00059 3-oxoacyl-[acyl-carrier protein] reductase
Accession: ani:AN5548.2 Score: 188 E_value: 3e-13
KOG Definition:
Classification: [Lipid transport and metabolism, General function prediction only].
Kog Number: KOG4169 Score: 166 E_value: 6e-13
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 123 E_value: 7e-08

Sequence:
>SY0AAB40YA21FM1
TTGGCTTTTATTCATTTTAACTTGCACCAACTCTTATATTTCCGAAAAGT
CCCCCCCCCCGCGCACGGGTTCTACTCGAGTATGCGCCTACCTAACTAAC
TCCACTTCTCACTCCCAACATCCTTCTCAAACAATATGTCGACGTTAGTA
CCTCAGATCAAGGTGGCCACGCCGACAGCTCCGCCGATTCCACAACGCAA
GGACAATCCTGCAGTTGCCAGATTCTCGCTCACTGGGAAGGTTGCTATTG
TTACTGGTGGAGCGGGAGGTCTAGGGTTTGAGGCTGCGCGAGCACTCCTA
GAACACGATGTTTCTGGCCTCGCCCTCTTTGACATCAACCACGATGCGGG
TCTCCAGGCCGTCGACCAGCTGAAGTCTGCATTCCCGGAAGCCAATGTGA
TGTTCCGGCTCGTTAATGTTACGGATGCGGCACTTGTCAACGCAGCTGTA
AACGTGGTGGCGGAGGTATTGGGCAGTGTGGATATCCTACTTGCGTTCGC
GGGAATCGTTGGGTGTGTTCATGCGGAGGACATGACGGTGG

Sequences in the Contig:

SY0AAB40YA21FM1