Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YO09FM1
Length(NT) : 674
Best Gene Model Blast : Link to GSTUMT00003883001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU11374
Accession: ref|XP_001728081.1| Score: 148 E_value: 4e-08
KEGG Definition: hypothetical protein
Accession: ncr:NCU08931.1 Score: 148 E_value: 2e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB3YO09FM1
TTGGGCCTGTCGCGAATGAGAAGTTTCGCAATAAGCAGAACTTGACATAC
ACACTCCTCTGTGACCCGACCTACGAGCTCCACGAAAAGCTTGGCATCAA
GAAGTCGCCCAAGGGAACCGTCCGCAGTGTCATCATTATTGAGAAGACCT
CGGGCGACGCCGCCGCCGCCACGCACCCGGGCAAAATTCTGCGTAAGACG
AAGGCCTCCGCACACGTGTCGCTTCAGGTTGCTAAGGAAGTTGTCGGCCT
TGATGGTACGAAGAAGGATGCTGAGGGTGGTGGGAAGAAGGATGCTGCGG
GTGACGTTACGTTGCCGGATGCTGGGGCTGCGGGTGAGGGGGTAGCTTAA
TTCTCTTTACTGCTCTCCACTTCTTCCTCTTCTGTCTATAAATATTCGAT
CCTCATCTGTGGGGATTGGCTGCTGTTGGGAATTTCTTGTTTGCTCATTT
GTCTTTCTGTCATACCTGAGTATGGGTTTGGTCTTCGGGTTAACAGTGAA
GTCTGGATGATGGGAACCGGGGAGAAAAGAGGCGGGGATAGAGAGCGGGG
GAAGGGGGGCGCGAGTAGTTAGGTAGGTTCTCGCTTGTTGTGTCTCTGAT
TCGATGTAGAGTACCGGTAGATCAGATGAGATGAGGAGGTCATCCTCCCC
GCTTGTCCCAGCTCTGCCCACCAT

Sequences in the Contig:

SY0AAB3YO09FM1