Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YM07FM1
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00009731001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g00570
Accession: ref|XP_001394061.1| Score: 183 E_value: 2e-18
KEGG Definition: hypothetical protein
Accession: ang:An11g00570 Score: 183 E_value: 8e-19
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2894 Score: 152 E_value: 3e-11
PFAM Definition: XAP5, XAP5 protein. This protein is found in a wide range of eukaryotes. Its function is uncertain. It is a nuclear protein and is suggested to be DNA binding..
Pfam Number: pfam04921 Score: 170 E_value: 3e-13
Swissprot: Q9WV03|FA50A_MOUSE

Sequence:
>SY0AAB3YM07FM1
TTGGGACGAAGAATACACTTTTGAGGGAGGCTCAGGAGCGCGAGATTTTG
CGGCGGGAGTTTTTGGTTTTGCCAAAGAAGATTAAGAATGAGGAGATTAG
GGTTCTGTTTGTTTTTTATGATAGGCATGAATGTTGCTCTGCCCACCGGA
GAGGGAGTGATGGTTAAGAAAGGCGAGGCTGTATGGTTCTTTTTCGAACG
TGCTTGGAGAATGTCTGGACCCCGGGAGTCGCTCTGGATATCGGTCGATG
ATTTAGTATTTACTGCCCGTCCGATGCACTTTGAATTCTGCTACTTTATC
GTCAATCACACCCTGGGGCCCAACGGATTATTATTTCATTTTCCTTCATC
CCCAACGCCCACCCCCCAGACCCGCACTCCGAATCCCAATAGAGACAACC
CTACGGTGACTAATATGGTGGATCGCCGCTGGTACGAAAATAAGCACATA
TTCCCCGCGAGCGTGTGGACAGAATTTGACCCACATAGAGGTTACTGGAA
CATGGTAAGGCGGGATATGGGTGGGAATACTTTTTCCGGTTAAACCAGCT
CCCTCTCAGTGGTCAACTCTGGCTGCTCCCTGGT

Sequences in the Contig:

SY0AAB3YM07FM1