Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YJ06FM1
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00004931001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 484 E_value: 4e-47
KEGG Definition: hypothetical protein
Accession: ani:AN3547.2 Score: 438 E_value: 4e-42
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 241 E_value: 2e-21
PFAM Definition: No Hit Found
Swissprot: Q05090|KLC_STRPU

Sequence:
>SY0AAB3YJ06FM1
TTGGCACCATACTGAGCCTCCATGGTCTAGCTATGGCGCTGCTTGATCAG
AAGAAGTTTGAAGAAGCGGTAATTACGTATCGGCGTGCGGTGGGCAGTAT
GGAGAGGGCACTGGGACCCGATCACCCATTCACACTCGAGAGCATCAACA
TGCTAGGCGAAATACTGCTTGATCTGAGAAAGTATGAGGAAGCGGAAGTT
ATGTGTCGACGTGCTCTGGCAGGTAGAGAGAGGACACTTGGACTACTTCA
TCGAGATACCTTACTCAGTGCCAATAATCTTGGAGTGGCACTGTGTAATG
AGAGAAAGCACTACGAAGCGGAGGTTATGTATCGGCGTGCCTTTCTGGGT
GCGGAGGAGATGCTTGGAGTAGATCATCAAGATACCCTCCTGTGCATCTA
TAACCTAGCTGGGGCGTTGTACAAACAGGGAAAGTATTACGAAGCGGAGA
TGATGTACTGGCGGGCGCTGGCGGGGCGAGAGAGAGTTCTTGGACCAGGC
CATCCACATACCCTCCGGTGCATCATTAAGCTGGTTGCCGTGTTGTATGA
TCAGAAAAAATTCGGTGCAGCGGAGACTATGTATCAGCGTGCTGTTACGG
AGGGGGAACAAGCTCTAGGGCCAGATTATCGGGAGGGTC

Sequences in the Contig:

SY0AAB3YJ06FM1