Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YI19FM1
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00000530001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_05191
Accession: ref|XP_001795600.1| Score: 274 E_value: 9e-23
KEGG Definition: hypothetical protein
Accession: fgr:FG10609.1 Score: 252 E_value: 2e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB3YI19FM1
TTGGGGGACGAGCACCGGTGGAAACACTCTCGGCCTCGTTAGTCAGACAC
AGCAATGGTTCACCATGCTCATCGATTGGGACAATGCTGCTGATGACACC
GCTGTTCGAGCGGCTGGCAAGGCTGTCACGGATAAGTGGAGTGAGGTCTC
TAATGCTATGGGGTTCGGAAATCCCTACATTTACACCAACGATGCTTCCA
GGGACCAGAACCCTATTGCCAGCTATCCCCCTGCGAATATCGCACAGATG
AGGACTATCAGCCATAAGTACGATCCCAAGCAGATTGCTCAGATTTTGCA
GAGCGATGGTTATCTACTGTCCAAGGTCCCCTAAGTTCTCTCAGGTCATT
TATCTGTGTCTCCGTATTTGTGCATGCGTTTTCTCTCTTTCATATTCACC
CATCGCAGAGTATATAAGCTGTTAGGGAAGGAGGGGTGTTCTTGGTGTTT
CTGGTAGTTTTTGCTTTTTTATATATCTTTATGTTTATTTACTTGTCTAT
TACTTCTTTTCTTTTCCCTTTCCCTCTGATCTTTGGCGTGCTCCTCTGTC
TCTTTTCCCTTCTTTGCGTGAAAAAGGTTACCGAACCGCTGTTGGACCGC
TCCTACCTCTTTGTAATATTCACCCTCCTTTTTTGTCTTCCTTTTGTTTT
TT

Sequences in the Contig:

SY0AAB3YI19FM1