Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YG19FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00005871001 E-value : 1e-101
Numbers of ESTs : 1

Blast Results:

Nr Definition: U1 small nuclear ribonucleoprotein 70 kDa
Accession: ref|XP_001259339.1| Score: 203 E_value: 1e-14
KEGG Definition: hypothetical protein
Accession: ani:AN6903.2 Score: 200 E_value: 2e-14
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0113 Score: 209 E_value: 9e-18
PFAM Definition: No Hit Found
Swissprot: Q66II8|RU17_XENTR

Sequence:
>SY0AAB3YG19FM1
TTGGACAATGTTAAGGAGCCGGACCTTGAACGTGAGTTTGGCCGCTTTGG
GCCTATTGAAAGAATCAGGATTGTGCGCGATAAAGAGTGGTAAACATAGG
GGGTATGCGTTCATTGTTTACGAACGAGAGAAGGATATGAAGGGTACTTT
AAATTACAAACCCCCACCCCTCACCCCCACCCCTTGGTCACTGTGTTCCA
TTTTTTACACCCGATTCCAAGAAAGCGGAGCGGGTGCGATGAAAAAGAAT
TGCGTTTCCGTGGTTTCACGCCTCGTTTTTTTTACTCGCTATCACATGTC
TCCTCCCACCCCATACCCTTTTTGCTTTATCCGCCTTCTCTCCTCTGTTT
TACCCCTTTGGTAGGGAAATAAATTTAGAAGGAAAGTATGAACAGTAAAC
TGACAAGATGATTTTGGATATTTTTTCCATTCTGACCGATACAGCGGCTT
ACAAAGAAACTGATGGGATCCGTATAAAGGACCGCCGCGTCCTCGTCGAC
GTTGAGCGTGGCCGTACTGTCAAGGGCTGGAAGCCAAGGCGTCTAGGAGG
AGGCCTGGGTGGTAGGGGATACACCAAAATTCCTGTCACACGACCAACCG
GTCCATCATATTTTGGTCAAGATGGCCC

Sequences in the Contig:

SY0AAB3YG19FM1