Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YG05FM1
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Heat shock protein 90 homolog
Accession: ref|XP_001382506.1| Score: 552 E_value: 6e-55
KEGG Definition: HSP90; Heat shock protein 90 homolog; K04079 molecular chaperone HtpG
Accession: pic:PICST_69965 Score: 552 E_value: 3e-55
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 681 E_value: 2e-72
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 784 E_value: 2e-84
Swissprot: P46598|HSP90_CANAL

Sequence:
>SY0AAB3YG05FM1
TTGGGCAGTTTCCAAGTCTCCCTTCTTGGACGCTCTCAAAGCCAAGGACT
TCGAGGTTCTTTTCTTGGTCGACCCTATTGACGAGTACGCTATGACTCAA
CTCAAGGAATTTGATGGCAAGAAGTTGGTTGATATTACCAAAGATTTCGA
GCTTGAGGAGACTGAAGATGAGAAGAAGCAGCGTGAGGAGGAGGAGAAAG
CTTTCGAGGGATTGGCTAAGACTCTCAAGGAGGTTCTCGGTGAGAAGGTC
GAGAAGGTCGTCGTTTCCCACAAGTTGGTTGATGCTCCCGCTGCTATTCG
TACTGGTCAGTTCGGTTGGTCTGCCAACATGGAGCGTATCATGAAGTCAC
AAGCTCTGCGTGGTAAGTTTATCTCTTTCGGTGTTTGTTGACATATCCCG
ACATTAATTGATCTAGATACTTCGATGAGCTCGTATATGGCATCCAAGAA
GACCTTTGAAATCTCTCCTAAATCACCAATCATCAAGGCCTTGAAGGAGA
AGGCTGAGGAGGAAGGTGGTTCCAAGGCCGTCGCTAGCATTGCCACTCTC
TTATACGAGACTGCGATGTTGACTTCTGGCTTCACCCTCGAGGAGCCTAA
TGCCTTTGCTCAGCGTGTCAACCGCCTCATCGCTCTTGGTCTCCAAATTG
AGGAGAAGGACGATGAAGAAGAGCCTG

Sequences in the Contig:

SY0AAB3YG05FM1