Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YE21FM1
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00010825001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_00753
Accession: ref|XP_368491.1| Score: 136 E_value: 9e-07
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00753 Score: 136 E_value: 4e-07
KOG Definition: No Hit Found
PFAM Definition: SPRY, SPRY domain. SPRY Domain is named from SPla and the RYanodine Receptor. Domain of unknown function. Distant homologues are domains in butyrophilin/marenostrin/pyrin homologues..
Pfam Number: pfam00622 Score: 145 E_value: 2e-10

Sequence:
>SY0AAB3YE21FM1
TTGGATCATCATATCAACGATGCCACCGACCTCTACTCTACCTGCCTCGG
AGAAGCCCTAGGTTCCTGGGGCTACCGCTCTGGATTTATCAATGGCGACG
CCGAAGTTTATGATGAACCGGCTCCCCATTTTGACACGAATGACACCATA
GGCTGTCATTTTGACCGAGTACGAGGGGCGGTCTCATTCACCCTAAACGG
GAAACGAGCTAGCAAACCAATACCCGGGATCCGTGGAAAATTACGCCCAA
TGGTCAGACTCACACCGGGGGATAAAATTCGGACTAATTTCGGCAGCGAA
CCGTTTCTATACCAAATTCCCGAGCCTGCTGCTCCAGAGGCGTACATCAA
GGAGGCCTTTACACATTGGCCAAAGAGCATGTGGTACCACCATATAAGTG
ACGAGTGATGCCTCGCTCTATGTTCGGTTGGTTGATCGTATGAAATGATG
TTTGGGTCAGGTCTGCGGTAATGGACCCTAGGTCTATAAAAACGCGTAGG
AGCGGGAATTTCTTTTCTTGCATGTAATATCAATTTTCTTGACGAGAATT
ATTGATCAATGCGGGGGTAAAGGAGCCAGGTATTTACTTATCTTATCCAA
AAATTTCTCTATTACTATGAGGCTTCCTGAT

Sequences in the Contig:

SY0AAB3YE21FM1