Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YD13FM1
Length(NT) : 750
Best Gene Model Blast : Link to GSTUMT00010262001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10363
Accession: ref|XP_001551106.1| Score: 652 E_value: 2e-66
KEGG Definition: conserved hypothetical protein
Accession: mgr:MGG_06878 Score: 626 E_value: 9e-64
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0058 Score: 413 E_value: 3e-41
PFAM Definition: ABC_membrane, ABC transporter transmembrane region. This family represents a unit of six transmembrane helices. Many members of the ABC transporter family (pfam00005) have two such regions..
Pfam Number: pfam00664 Score: 173 E_value: 2e-13
Swissprot: P33310|MDL1_YEAST
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0015440 = Molecular function: peptide-transporting ATPase activity
GO:0006857 = Biological process: oligopeptide transport

Sequence:
>SY0AAB3YD13FM1
TTGGACGAAAGCCATTGCTACAAGCTCAAAGGCCCTTTCCAGGCTTCCCT
CCGTTCAATTGTGTCTCTCGAAGTGCTGTTTGGTCCCGGGGGAGATGTTT
GTCCACATCACCGATACTCCGTGAAGTCCGGAGCGGTAATACCACGGAAA
AGCCGCTTACTGAACCTCAAAAATCCACCTCGGTTGAACTCGAATTTGAG
GCCTTTGGTCGCTCAGAGAAGGCTACCAAGGCTGCTCAAGTTAATCTCTC
TGCGCGCTTGCATAAAGATGGGAATCCGAGTGCTGTGAAACCGGTTCTTG
GAGAAATAGTTCGATTATTGAAAATTGCGCGCCCGGAAGCTAAATGGCTA
TCAGTTGCGTTCGTCTTTCTCTTGATGAGCTCGGCAATCTCGATGTCTAT
CCCGTTCTCGATTGGCAAAATTCTCGACATGGCAACACGGACCGATGTGG
GCACTCTGCTTGGACTACAACTACCGCAGTTCTACATGGTCCTTGGAGGG
GTTCTATGCCTCGGTGCGGCATGCAATTATGGTCGCATAGTTCTCCTCCG
AATTATCGGCGAACGTATTGTAGCCCGACTCAGATCGCAGCTCTTCCACA
GGACCTACGTTCAGAATGCCGAATTCTTCGACGCTAATCGTATAGGGGAC
TTGATCTCCCGTCTCTCCTCGGATACAGTCGTTGTCGGTAAGAGTATCAC
TCAGAACGTGTCCGATGGCCTCCGTGCACTTGTTACTGGAACCGCTGGTC

Sequences in the Contig:

SY0AAB3YD13FM1