Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YC12FM1
Length(NT) : 702
Best Gene Model Blast : Link to GSTUMT00006365001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_14475
Accession: ref|XP_001584578.1| Score: 416 E_value: 4e-39
KEGG Definition: hypothetical protein
Accession: ang:An16g05380 Score: 361 E_value: 4e-33
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4836 Score: 254 E_value: 7e-23
PFAM Definition: TIM21, TIM21. TIM21 interacts with the outer mitochondrial TOM complex and promotes the insertion of proteins into the inner mitochondrial membrane..
Pfam Number: pfam08294 Score: 377 E_value: 3e-37
Swissprot: Q4X1I8|TIM21_ASPFU
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>SY0AAB3YC12FM1
TTGGCGCCCGCCAACACTCCCCTCTATCCCTGCTAGCCACCATCGCATCG
TCAAAAACATTCCTTGCAATGTCGGTCCAGCTATCAACTCCGGTTCGTTC
GATCACTTTGCGCTCAGGTATACGCGCAATCCGTGTCCCAGGCTCGTTAA
TCCACGCCCACCGCCGGCCATTCAGCGACACAAGAGCAAATTCGCAAAAG
CATAAAATAGCGATAACGTCCAGCAGCGCATCGAGCAAGAAATGGGAGGA
GCTTTCGAAGAGTCAAAAATTTGCACGAACAGCCAGCACGGGGGCAAGCT
TTGTGACAGTTGTCATTGGGGCGGTCTTAACTGGAGCCATCCTGGCGATG
CTCTACACCGAAGTTTTTGCACCCAATTCTATCCCCAACTGGTTCAACAA
CATACACAACAGGATCAAGGCAGATTCACGCTGCACCAAGTTACTGGGGG
AGAGGATCAAGGCGTACGGGGAGCCCACATCAAATCGTTGGGCCAGGAAC
AGGCCAATTGCTTCGAGCATTCGCAAAGACAAGCATGGCATAGAACATCT
AATCATGCACTTTAACGTCGAGGGCACTGTTGACAAGGGAGTTGTCAAGG
CTCACCTGACAAAGAGACCCGGGGAATCAAATTACGAGTACAAGTATTTG
TTCCTCCAAGTCCCTGGCAAAGCTCGGGTATACCTGGAAAACGGAAGGGA
TA

Sequences in the Contig:

SY0AAB3YC12FM1