Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YB22FM1
Length(NT) : 563
Best Gene Model Blast : Link to GSTUMT00006685001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein LOC100127748
Accession: ref|NP_001106556.1| Score: 653 E_value: 7e-67
KEGG Definition: hypothetical protein
Accession: ang:An08g06960 Score: 650 E_value: 8e-67
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG1745 Score: 592 E_value: 2e-62
PFAM Definition: Histone, Core histone H2A/H2B/H3/H4..
Pfam Number: pfam00125 Score: 263 E_value: 3e-24
Swissprot: P61834|H3_PENFN

Sequence:
>SY0AAB3YB22FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCACAAACTTCAATAACAATG
GCTCGCACTAAACAGACCGCTCGCAAGTCCACTGGAGGAAAGGCTCCTCG
CAAGCAATTCTCCCATAAGGTTGCTCGCAAGTCTGCCCCCTCTACTGGTG
GTGTCAAGAAGCCTCATAGGTATAAGCCTGGTACCGTCGCTCTTCGTGAG
ATTCGTCGCTACCAGAAGTCCACCGAGCTTTTGATTCGCAAGCTTCCCTT
CCAGAGGTTGGTTCGTGAGATCGCCCAGGACTTCAAGTCCGATCTTCGTT
TCCAGTCCTCTGCCATCGGTGCTCTTCAGGAGTCCGTCGAGGCTTACTTG
GTCTCCCTCTTCGAGGACACCAACCTTTGTGCTATTCATGCCAAGCGTGT
TACCATTCAGTCCAAGGACATCCAGCTTGCTCGCCGTCTCCGTGGCGAGC
GCTCTTAAACTTTCCCTTACCTCGTCTACAATAATGCTTCGTCTCAATAA
TTTGTTTCATCTTTAATTCTCTTGGTTTTCGATGGAACTAGTCTGCGAGA
TGGGGTTTTCTTT

Sequences in the Contig:

SY0AAB3YB22FM1