Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB3YA05FM1
Length(NT) : 692
Best Gene Model Blast : Link to GSTUMT00010730001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12819
Accession: ref|XP_001548675.1| Score: 331 E_value: 3e-29
KEGG Definition: hypothetical protein ( epithelial zinc-finger ezf related protein [imported] - Neurospora crassa OR74A )
Accession: ncr:NCU01629.1 Score: 326 E_value: 5e-29
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2462 Score: 201 E_value: 8e-17
PFAM Definition: No Hit Found
Swissprot: Q09838|PRZ1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0003700 = Molecular function: transcription factor activity
GO:0019722 = Biological process: calcium-mediated signaling
GO:0006874 = Biological process: cellular calcium ion homeostasis

Sequence:
>SY0AAB3YA05FM1
TTGGGCGGACCATCTCCTATGAAGCGACCTCGGGACGAACTTTCCTCTGT
TGTTGGATTTGGAGGTCAGTTCCATTCGGGTGCGGCAGGTACCTCTGGCG
TCAGTAGGGTCCGTAAGAAGCGCCATTTGACCGAGCCCAGCGAGGCCAAT
TTTCACTGCACCAAGTGCGGGAAATACTTCTCGAGGATCTGGAACTACAA
CGCGCACTTAGAGACCCACAACCCTCACCGACCCAGACCTCACGTTTGCC
CTGTCGACGATTGCAAGAAGGCTTTTGTCAGACGAACCGACTTGACCAGA
CATCAGCAATGTGTGCATGCTAAGGATAAGAAATTCCGCTGCGAACTTTG
CAACAACATGTTTGCCCGCAAGGACACTCTTAGAAGACATGAAGATGATG
GTTGTCCAAAGCGCGTCGATATCGCATCCAGAGGATCAAAGAACAAGCCC
ATAGTCTGGAACTCGCAAGCACTCGGTTTCTACAGCGCAATGCAGCGCCG
CGACGAAGTACTCCCAAACATGACTGCCTATGACCCCCAAATGCGACCAA
ATCACTACGATAACGGAATGTCCTCTCATCTCCCTCCTCTCTCGGACATC
GTTCCAAAGACTCCATCATCAGTCCTGTGGGGCTAAGCACACCGTCCTTC
TAGGGATCGTTGTTTCTTGTACAATCTTCTTTTCCTTTTTCC

Sequences in the Contig:

SY0AAB3YA05FM1