Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB39YO02FM1
Length(NT) : 617
Best Gene Model Blast : Link to GSTUMT00004582001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein ACLA_040840
Accession: ref|XP_001271294.1| Score: 292 E_value: 7e-25
KEGG Definition: hypothetical protein
Accession: ncr:NCU01044.1 Score: 281 E_value: 6e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB39YO02FM1
TTGGCCACTATTCCCGGATTTCTGGTGCTCAAGGCCGCTAGCAAGGGACA
TTTCCTCCTGGCATGGGTAGGCTTTGTATCCCTCCTCGTGGAAGTCCTCA
CCGTGGTAATGGGTTCGCTGGACAGTGGTGGCGGCGAGGAGTCCGACCTC
AGCTTCACTGTGTCCTTCGTTCTGGCCGTTATAATCCTGTCCGTGACAAT
CCTAACAATGAGCCTCGTGCTGCATCTTCGCCGATCCCCGTTCCTTCCCC
GCCAGCCCGGGACCATATCATCGGTGCTGGCGTTCATACACCAGAGCAAG
ATGCTGGTGGACTTTGAAGGCACAGAGGAGGAGAGCACTGCCGTGCGGAA
GAAGAAACTTAGACGGCTGGGACATACTTATGGCTTCGGCTGGTTCAAGG
GACGCGACGGGGTGAGGCATCTGGGTATTGACCATGAGGAGCTATTGCAA
GGATATAAGTTTGGGAAGAATGCGCTGGATGGGGTACTCGACAGGGTGGA
TTGGGAGCATTATTCTGTCTAGTTGGATGGGGGGGATGGAGAGGTGGAGG
TTGTTGGGGGAGAGAGAGGGAGGGGGTGTTTCATTTGGCTTTAGCTTGGC
TCTGGCGTTTACGTTGC

Sequences in the Contig:

SY0AAB39YO02FM1