Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB39YL17FM1
Length(NT) : 538
Best Gene Model Blast : Link to GSTUMT00004674001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: mitochondrial ribosomal protein L43
Accession: ref|XP_753305.1| Score: 492 E_value: 3e-48
KEGG Definition: mitochondrial ribosomal protein L43, putative
Accession: afm:AFUA_5G13490 Score: 492 E_value: 2e-48
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3445 Score: 368 E_value: 3e-36
PFAM Definition: L51_S25_CI-B8, Mitochondrial ribosomal protein L51 / S25 / CI-B8 domain. The proteins in this family are located in the mitochondrion. The family includes ribosomal protein L51, and S25. This family also includes mitochondrial NADH-ubiquinone oxidoreductase B8 subunit (CI-B8) EC:1.6.5.3. It is not known whether all members of this family form part of the NADH-ubiquinone oxidoreductase and whether they are also all ribosomal proteins..
Pfam Number: pfam05047 Score: 187 E_value: 2e-15
Swissprot: Q06090|RM51_YEAST
Gene Ontology:
GO:0005762 = Cellular component: mitochondrial large ribosomal subunit
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0009060 = Biological process: aerobic respiration
GO:0006412 = Biological process: translation

Sequence:
>SY0AAB39YL17FM1
TTGGTAACCTCTTGCTCCCCTTGATCGATTGAACAAACAGACGGACAGAC
GAAGGAGCGATGCCTGTCTCAGCCCTCCAAGCTGTCTCGAAGTCCCGGAA
TGGTGTAGGGGCTTTTATTCTCCAGTGTAAACGCATGGAATTCAATTTCT
GTGATTGGGCTGGGAGCTCAAAAGGGATGAGGTCGTTCCTAAAACATTCA
CTACCACAATTTGCCAAAGAAAACCCGCAGATAGAAATCATCGTTGCCCC
ACGACCCAACAAAATACCGATAATCCGTGGCGTCTATATCAATGGTCGTG
AGAAGGTCATTGCGGTCGATGGGTTAGAGATTCAACAAATCCTCCAGAAG
GCACAGCTTCTCCGAGACTCCTCCGGCGCAAAATTGAAAAGGATTACCAA
GCCAGTCATTTCGTTGAACGAGAGTGTAAGAGGAATGTTCTCGCCATTCC
ATGGGGAGAAGCATGTCATCTAGATGGCGGATATTTGGCGCTCCATTGCA
CATAATTTATTATTTGTATAATATATTTTCAAGTCTAT

Sequences in the Contig:

SY0AAB39YL17FM1