Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB39YK07FM1
Length(NT) : 453
Best Gene Model Blast : Link to GSTUMT00003244001 E-value : 1e-177
Numbers of ESTs : 1

Blast Results:

Nr Definition: 60S ribosomal protein L7
Accession: gb|AAY86760.1| Score: 486 E_value: 1e-47
KEGG Definition: hypothetical protein
Accession: ncr:NCU07829.1 Score: 482 E_value: 1e-47
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3184 Score: 376 E_value: 2e-37
PFAM Definition: No Hit Found
Swissprot: Q7SBD5|RL7_NEUCR

Sequence:
>SY0AAB39YK07FM1
TTGGCCGTCCGTGAGTTGATCTACAAGCGTGGCTACGGACTTGAGGTTTG
GTTCACCGTATGCAATCCATGGCTCAAGTCCGTCCGTGAGTTGATCTACA
AGCGTGGCTACGGAAAGATTGATCGCCAGAGAATCCCCTTGACCGATAAC
AAGCTTATTGAGGAGAACTTGGGCAAGTATGGAATCATCTCCATCGAGGA
TCTTATCCATGAGATCTACACTGTCGGCCCTAACTTCAAGCAAGCTTCCA
ACTTTCTCTGGCCCTTCAAGCTCTCTTCTCCCAACGGCGGTTTCCGCACT
CGCAAATTCAAACATTTTGTCGAGGGCGGTGACTTGGGTGATCGTGAGCA
GTTCATTAACCAGCTCATCCGTAAAATGAACTAGAAACTGGAGGTTGTCA
CAATTTCTTATTTTTCCTATTAGGGGTTCCAAATAAACGGTTCTTTTCCT
GCC

Sequences in the Contig:

SY0AAB39YK07FM1