Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB39YE05FM1
Length(NT) : 390
Best Gene Model Blast : Link to GSTUMT00011868001 E-value : 3e-93
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An06g01930
Accession: ref|XP_001391014.1| Score: 271 E_value: 9e-23
KEGG Definition: hypothetical protein
Accession: ang:An06g01930 Score: 271 E_value: 4e-23
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3506 Score: 255 E_value: 2e-23
PFAM Definition: Ribosomal_S14, Ribosomal protein S14p/S29e. This family includes both ribosomal S14 from prokaryotes and S29 from eukaryotes..
Pfam Number: pfam00253 Score: 161 E_value: 1e-12
Swissprot: Q9C2P2|RS29_NEUCR

Sequence:
>SY0AAB39YE05FM1
ATACCAATCCAACCGCTAACGCACGGCCAATTTTTAGCTCCAACGTAAAA
TAAACACAACACTCGACAATCATGGCTCACGAGACAGTTTGGTACTCTCG
CCCTCGCTCCTACGGAAAGGGTAGCAGATCTTGCCGCGTATGCGCTCACA
GGGCCGGTTTGATCCGTAAGTACGGACTCAACATCTGCAGACAGTGCTTT
AGGGAAAAGTCCACCGATATCGGTTTCGTCAAGATGCGATAAATCATGTC
GGTTCGGCGGCTGGGGGCGCGAGGGGGCCCCCGGGGGAGTTTATAAAATC
TGGGAGCGGTGTTCTCTTTTTTCTCTTTTTCTCCCTAAGTTTCCGTACAC
AGAATGTTACCGAATCAATGAACGGGAATGTTTCAACGGG

Sequences in the Contig:

SY0AAB39YE05FM1