Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB39YE01FM1
Length(NT) : 365
Best Gene Model Blast : Link to GSTUMT00009830001 E-value : 1e-109
Numbers of ESTs : 1

Blast Results:

Nr Definition: 60S ribosomal protein L29
Accession: ref|XP_001550019.1| Score: 320 E_value: 2e-28
KEGG Definition: hypothetical protein
Accession: ncr:NCU00315.1 Score: 310 E_value: 1e-27
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3504 Score: 190 E_value: 5e-16
PFAM Definition: Ribosomal_L29e, Ribosomal L29e protein family..
Pfam Number: pfam01779 Score: 175 E_value: 3e-14
Swissprot: P05747|RL29_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAB39YE01FM1
TTGGCAACAACACATCTGCTATCATCCGCCTCACGTAATGGCCAAGTCTA
AGAACTCGTCTCAGCATAACAACAGCGCGAAAGCGCACAGGAATGGTATC
AAGAAACCAAAGACCTATAGATATCCTTCCTTGAAGGGAACCGATCCTAA
ATTCCGAAGGAACCACAGACATGCTCTTCACGGAACTATGAACGCCTTGA
AAGAGCTCAAGGAGGGAAAACGCGAGACCGCCTAAACACATCTTACGGTC
CGACTCTCTTTCAGGTTTTTTTTTTTTCGGGCGGAGTTTAGTAATTGACT
TGGCTGGGGTATGGCATGACGGATTAATGGTGGACGCGACCTTAGAATGT
CAAACATTTCCCGCG

Sequences in the Contig:

SY0AAB39YE01FM1