Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB39YB06FM1
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00010576001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An02g02890
Accession: ref|XP_001399429.1| Score: 370 E_value: 7e-34
KEGG Definition: hypothetical protein
Accession: ang:An02g02890 Score: 370 E_value: 3e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB39YB06FM1
TGGCACCTTTGACACACTTCAAACCCACCATCCTCTCACACGAAGAAAAG
CTCACCGGCCGCCGAAGCCTTTGGGAGCGCTCCTACGACCTCTACGATGG
CCAGCCCAATGACCCCCTCTCTACAGCCCAACATTCCCTCTACCAATCCC
TAATGCCACGGCCCTCATCCACCGGTAACGACTCAACAGTGAATATGGGC
GCCATCACCCCTGCCCGTCCCACACTTGCTGGTTTCGGCGGTTTCGGTGC
ACACTTAACAGCAGCCGATACAACCCCTCGGTCCTCTATAGCCGGTTCCC
CAGCCCCTGAAGGCACTCCCGCACCCCCGGGGACAACAACGCCACTCGTT
CCTGGTCCCGGCGGTATTCCACACCCAGGCTCGGTCGGCGCCCCCCAACC
TACCGGCCCAACACCCATGGAACAAGCCGAGGACCGCGATCGGGTAGTCC
CCATCATGCCCCTTGACGCAGCAATAGTGGAGAGCATAACCCACGCTGCC
AAAGGTGAGGAGAAGAAGATTAAAGACTTCCTAGCCAGCATCATGGTCGT
TGGTGGGGGCTCGCTGGTCTCGGGATTCAATCACCAACTCGAAGAGCGCA
TTCGTGCGCTCAAGCCGAGTAAGGACTATCAGATCATTATTGGCGTCCCA

Sequences in the Contig:

SY0AAB39YB06FM1