Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB38YO14FM1
Length(NT) : 505
Best Gene Model Blast : Link to GSTUMT00008909001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_08851
Accession: ref|XP_001590087.1| Score: 347 E_value: 2e-31
KEGG Definition: hypothetical protein
Accession: fgr:FG01228.1 Score: 266 E_value: 2e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB38YO14FM1
TTGGATAAAGCATTACGTCGAAGACGACATGGAACACATCGACATCGAGC
AGACCGCGACTGGCGGTATCAAGGGGACCACCGAGAATCGAATCCTGGAC
TGGAAGGAGAGGCCGCATGAAGACCACCTCTTTGGCAAGCTCATTGCACA
GAGCCGCAGGACTAATCTTGAGGATGTGCAGGATGAGTTCTTGAAGAAGG
ATTGGTTGGAGGGCGAGGCGAGGGAGGATGGACTCATCGAGGCTTTTGCA
GTTAGTGAAAATGGGTGGAATGCGCGTCAGGTTTGGGGATTTGAAGAGTT
TGATGGGAAGAGGCATTATTCTCGCCATCTTAGGTTCGAGAAGGGTGATA
AGACATTGTTCAAGAAGATGGTTTACGATTACTTTGAGTAGGTTGGGGGA
GGTGCTGTTTTTCGCTTCTTTTGCTGCTGCCTTTCTTCTAGTCTACTCTA
TAGTAGCTATATATAGGTATAATAGAAACCTTGAGTAGTTCTCATCTTGG
AGAAA

Sequences in the Contig:

SY0AAB38YO14FM1