Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB38YM20FM1
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00007213001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An03g06650
Accession: ref|XP_001390540.1| Score: 501 E_value: 5e-49
KEGG Definition: hypothetical protein
Accession: ang:An03g06650 Score: 501 E_value: 2e-49
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB38YM20FM1
TTGGCTGTGGTTTTCATGGACTATAAAGCCGATGAGGGCACCATACCCTA
TATTCTGGATGAATTCAAATACATGTGGGAAACACCGTTCTCACCAACGG
ATGAGAATTTCCCCTGCACGATTGACCGTCCTCCGGATCAACCCAAGAAC
GACGCGCAAGGAAAACTATACATGGCGAATCATAACCTGAATACCGAGAT
TTCACTTATCGGGCACAAGGTTTTAGTCCCCGACACTGATTCTCTTAATC
AGACCAACGGCGTTTCAGGGTTTGGATCATTAGGCCTCATGGCGAACAAT
TGCAGAGCTGATTGGGACCGATACCCAAATTTCCTTCTTGTAGACTTCTA
CGACGTCGGCTCCGTCTTCGAAGTCGCTGCTAGAGCAAACGATGTTGAAT
ACAATCGTCCATGCTGCGGAAAGAGAAAGTCCACTGCATCACCACTAGTG
AAGGCCACAGACTCGCTTTTGCTCCTTCCAACTCTCGCCATACTTCTTTC
TATCGTTCTCTAGTCCGGCAGGTCGTGGGAAACAATGTTCTGGGTTGCTT
CTATTCGGGCTTGTATCAGGGTTTTGGAATGAGGGGAGCTTATTGGGGGC
GTTTTTATTCATTTGGGGAACAGAGGTGGGCTTTTGTTATTATGAGTTTC
TAGTATCATGGGCTGGG

Sequences in the Contig:

SY0AAB38YM20FM1