Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB38YJ21FM1
Length(NT) : 459
Best Gene Model Blast : Link to GSTUMT00009843001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_04845
Accession: ref|XP_001556827.1| Score: 247 E_value: 5e-20
KEGG Definition: hypothetical protein
Accession: ang:An14g06170 Score: 231 E_value: 2e-18
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 175 E_value: 4e-14
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 123 E_value: 4e-08

Sequence:
>SY0AAB38YJ21FM1
TTGGGCCACGACGACGCCGGCGTCAACAACAACCTCCTTCCAAATCCTCT
CAGACCTCCACCTGGAAGCGACGCAGACGCCGCCAAATACTTACGAGACC
TTCCAAATCCCGCCACGAGCGCCATACCTCCTGCTGGCCGGGGACATAGG
CCTCCTGACGCCGAGCCACTACCCGCGCTACCTCCACTTCCTGACGGCGC
ACGTGCACAAGTTCCGCCAGATCTTCCTGACGCTGGGCAACCACGAATTC
TACCACCAGTCCCGCGACGAGGCGCTGCGCGCCGCGTCGCGACTGGAGAG
CGAGCAGGCGCTGGAGGGCCGGGTGAAGGTGCTGTACAGACGGGCGGTGG
AGGTGGCGGTGGAGGTGGGGGAGGGGGAGGAAGAGGTGGTCTGCGTGCTA
GGCGTCACGCTGAACACGCACGTGCCGGAGGAGGCGGCGGCCGAGGTGGC
GGCGAGGGT

Sequences in the Contig:

SY0AAB38YJ21FM1