Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB38YI02FM1
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 1e-170
Numbers of ESTs : 1

Blast Results:

Nr Definition: ATP-dependent molecular chaperone HSC82
Accession: ref|XP_001540846.1| Score: 548 E_value: 1e-54
KEGG Definition: sspB; heat shock protein sspB-Aspergillus niger
Accession: ang:An09g06590 Score: 535 E_value: 2e-53
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 535 E_value: 1e-55
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 667 E_value: 7e-71
Swissprot: P40292|HSP90_ASPFU

Sequence:
>SY0AAB38YI02FM1
TTGGGTGGGAGCGCCGCGGCGGGGTGGAGCGGTGATAGTGTTTGTTGTGG
GCACGGCAATGAGCTGGGCGAGGGAAGAGTTGGTGGGCAGAGATTCGTGG
GTATGACCCTTAGGGCGATAACGGGATTTCCTGGGTTGAGATTATTTTCC
CTTTTTTTTCTCGTTTGGTTTTTTACTGTAAAGCCTGCAAGTCTCCCTGG
ATTGCCCTGATTTGATTCCGGAATGGCTTGGTTTCATCAAGGGGGTTGTC
GATTCTGAGGATCTCCCACTTAACTTGTCTCGTGAGACTCTCCAACAGAA
CAAGATCTTGAAAGTTATCAAGAAAAACATTGTCAAGAAAACTCTTGAGA
TGTTCAACGAGATCTCCGAGGACCGTGAGCAGTTCGACAAGTTTTACAGT
GCCTTTAGCAAGAACATTAAGCTTGGCATTCATGAGGATGCCCAAAATCG
TCCTGCCCTTGCCAAGCTTCTCCGCTTCAACTCTACTAAGAGCGGGGACG
ACGCCACATCTTTGACTGACTACGTTACCCGCATGCCCGAGCACCAAAAG
CAGATGTACTACATCACTGGTGAGTCTTTGAAGGCAGTTTCCAAGTCTCC
CTTC

Sequences in the Contig:

SY0AAB38YI02FM1