Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB38YG19FM1
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00009065001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN7049.2
Accession: ref|XP_664653.1| Score: 543 E_value: 5e-54
KEGG Definition: hypothetical protein [EC:2.7.-.-]; K05285 phosphatidylinositol glycan, class N
Accession: ani:AN7049.2 Score: 543 E_value: 2e-54
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2124 Score: 451 E_value: 6e-46
PFAM Definition: PigN, Phosphatidylinositolglycan class N (PIG-N). Phosphatidylinositolglycan class N (PIG-N) is a mammalian homologue of the yeast protein MCD4P and is expressed in the endoplasmic reticulum. PIG-N is essential for glycosylphosphatidylinositol anchor synthesis. Glycosylphosphatidylinositol (GPI)-anchored proteins are cell surface-localised proteins that serve many important cellular functions..
Pfam Number: pfam04987 Score: 330 E_value: 6e-32
Swissprot: Q5AXD1|MCD4_EMENI
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAB38YG19FM1
TTGGGGTTATTCTACGTGATTTTTTGCCTTACGCTGGTTGCCTGGGTCCA
GTTGGAGCACAAAATCCACCAGCACTCGCACCGAAAGATGCAGGAGTCTC
GGGGATCTCGCAAAGGGGAAACGAAAGATGCACCGGGCGGTGTACCCAAG
AAGGACTCAACGGCTTCCGCAGCCGAACCACTGACCCCGCATTCCCAAAC
ATGGAGGGGACTAACCCTTGCTGATGCAAGGATCGCACTGTTCTTCTTCT
TCTTGATTCAGGTGGCGTTCTTCGGAACTGGCAACGTTGCTTCATTGTCG
TCTTTCTCTCTAGAGAGCGTATATCGCCTTATACCCGTGTTTAATCCCCT
CGCAATGGGGGCGCTTTTGGTTTTAAAGCTGATGGTTCCGTTCGCGGTGA
TCTCAGCGAACCTTGGGATACTGAACAGGAGGATCGGAGTGGCACCAAGC
TCTCTGTTCATGGTGGTCATGGCCATATCAGATGTCCTAACACTCAACTT
CTTCTATATGGTTCGGGACGAAGGGAGCTGGTTGGACATTGGCACGACCA
TCAGCCATTTCTGCATATCGAGCATGTTGGGAGTTTTCGTCTCGGCA

Sequences in the Contig:

SY0AAB38YG19FM1