Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB38YC21FM1
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00010228001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: nitrate reductase
Accession: gb|AAN64993.1| Score: 959 E_value: 1e-102
KEGG Definition: niaD; nitrate reductase (NADPH) niaD-Aspergillus niger [EC:1.7.1.3]; K10534 nitrate reductase (NADPH)
Accession: ang:An08g05610 Score: 603 E_value: 3e-61
KOG Definition:
Classification: [Coenzyme transport and metabolism, Energy production and conversion].
Kog Number: KOG0534 Score: 448 E_value: 2e-45
PFAM Definition: FAD_binding_6, Oxidoreductase FAD-binding domain..
Pfam Number: pfam00970 Score: 275 E_value: 2e-25
Swissprot: P36858|NIA_ASPNG
Gene Ontology:
GO:0050464 = Molecular function: nitrate reductase (NADPH) activity

Sequence:
>SY0AAB38YC21FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTTCTTGGATCCACGAGCATGGTGTCAAGCAGCCCTAGTGCAG
AAAAAGGTGGTATCATGGGATACTAGAATTTTCACCTTCGAACTCGATAA
TCCTACACAAACACTAGGTCTTCCCGTCGGGCAGCATCTTCTCATCAAGA
TACGGGACGAAAAGACCGGAGAGGTGATTACGCGGCCGTACACTCCCATC
TCATGTAACACTGAGAAGGGTGTTGTTCACCTACTCGTGAAAGTATATTT
CGATACACCAACCGCTCTTGGTGGAAAGATGACACAAGCTATGGACAGGA
TGCAAATGGGTCATACCGCTTCCTTCAAGGGTCCCATCGGTAAACTTGTA
TATCATGGGCAAGGTGTCGTTTCTCTCCTTGACAATCGGATCAATGTCAC
ATCATTCCTTATGATCTGTGGCGGAAGCGGAATAACTCCCATTTTCCAAG
TCCTCAGGGCAGTCCTTTCTGACCCTACGGATTCTACAACGTGCGTTGTC
CTCGACGGGAACAGAGCAGAGGAAGATATTCTGTGCCGAGAGGACTTGGA
TTCGTTCGCAGCGACATATCCGGAAAAGTGCAAGATCGTTCACACTCT

Sequences in the Contig:

SY0AAB38YC21FM1