Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB38YC10FM1
Length(NT) : 568
Best Gene Model Blast : Link to GSTUMT00009784001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_05978
Accession: ref|XP_001242082.1| Score: 175 E_value: 2e-11
KEGG Definition: conserved hypothetical protein
Accession: mgr:MGG_04927 Score: 164 E_value: 2e-10
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2533 Score: 134 E_value: 3e-09
PFAM Definition: No Hit Found
Swissprot: Q10097|YAOI_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAB38YC10FM1
TTGGAGAAAAACAGACTCCGCGCTGCACGTGGCCCTTCCAACCCTGAGCT
CTTTATCCGGCTGCTCTGGTGTCAAGATCGACGAGCCAGACGACTCACCA
ATGGGATACGGGCCTAGTAAACGCCTCACCTTCCTCAATCCAAGCATGGT
ATTTCCTCCGTGCTTCACAAGCCCGCGACAACACACCGATTTACTTTTGA
TTCAGAAAACTAGCTTTGCAATCGCAATCCGAGCATATAAGTCCTCGATA
GGTCCCAGGGTGTGTCCCTGTGGGGTTGTACAGCCCCGAGTGCTTGTTCA
CTACAGATACTGCTACATTATGGATTCCTACGGAAAAAGTACTACTGTCT
CACCGTCTGTTGTGTCGATAAATGCCTCCCCTCAACATCAAACAAACACC
ATCAAGCCAGGCCCGAATGCCACCGAGCGAAAGCTACTGGCAAAGATAGA
CATCAGGCTGATACCTATCTTAACTATCTTATACATCCTGGCCTTTTTGG
ACCGTGTAAATATCTCCAATGCAGCAATATTCGGCCTGAAGGGGGATCTC
GACCTCGGAGGCGTCGAA

Sequences in the Contig:

SY0AAB38YC10FM1