Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YP19FM1
Length(NT) : 629
Best Gene Model Blast : Link to GSTUMT00007725001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001259490.1| Score: 287 E_value: 3e-24
KEGG Definition: hypothetical protein
Accession: ani:AN0095.2 Score: 268 E_value: 2e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: A1DDY6|IRS4_NEOFI

Sequence:
>SY0AAB37YP19FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGTACACGTCCAAGCCCTATC
CCCCACCATCAGACCGGCGACTCTATCCTAGCAGCCTCCCTTGCCTCCTC
CAGGGTCGTCTCCTCCTCCCCCCGAAAACCGCCTGCACCGCCCGCACCCC
GTCGCCGCCGATCACTTCCTCCTCCACCAAAAAGTCTTCGCGAAACAATG
CGCAAACCCAGAACACCACCCGAGGAGCCATCCCCTCACCGCAGAAACCC
CCACCTCGTAAAGCACCCACACAAACACAGCGAAGGAGAGTGCAAACGCT
GGCGACACTTTGTCACAGAGGCCGAACGGAAACGCTACGACGGTCTCTGG
GCCGCCAACAAAGGTCTCCTGCTACCTACATCGGCACCTCCACCTCCCCC
ACCCCGTGGCAGAGCCACAGCCCGTAACTTCAATGATGAGCAGCACGAAT
GGAGCTCCGCTCCCACATATGCGGAGCCATTATCCGATTGCGTCCACTCG
CTGATCGTGCGGGACATATGGCGGCGTGCTAGACTACCCGACGATCAGCT
CGCTGAGATCTGGGAGCTCGTGGACCGGGAGGGAAACGCCAGGTTGAGTC
GCGACGAGTTTATTGTCGGCACCTGGCTG

Sequences in the Contig:

SY0AAB37YP19FM1