Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB37YN04FM1
Length(NT) : 536
Best Gene Model Blast : Link to GSTUMT00006472001 E-value : 1e-153
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001539304.1| Score: 265 E_value: 6e-22
KEGG Definition: hypothetical protein
Accession: spo:SPAC3G9.15c Score: 220 E_value: 5e-17
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3100 Score: 251 E_value: 9e-23
PFAM Definition: Fcf2, Fcf2 pre-rRNA processing. This is a family of eukaryotic nucleolar proteins that are involved in pre-rRNA processing..
Pfam Number: pfam08698 Score: 256 E_value: 3e-23
Swissprot: Q8R2M2|TDIF2_MOUSE

Sequence:
>SY0AAB37YN04FM1
TTGGCGCAATGCCAACAGAAGAAACCCCTGGTCTCCATAAGGAATCAGCA
GAAGCAGAAGCAGTGCCAGAAGGAAATAGAATTGACGTGGTCGAGGGCCC
ACCCGCTCGCTTGTTTTCCTCATCTCATGTCCGCAGTGACGGTTTTGGAG
ACGATGTCGCTGAGCTGTCGGATGAAACAGTCGGCCGCCTGCTCAGCGAG
GCGGAGGAAAGAATGAAATCCTCGTCTAAAACATTATCAACGTCCTCTAG
CACTAATCGCAGCAAAACCTTGATGACAAACAGCTGCAGGAGGAGTATCC
CTTGTGGATCCAGCGTTATCAAAGAAAAGGCTCAAAGAGGACGAGAAAAC
TGCTGGATTGAAGTGGTTTGATATGCCGCGTACCAACCTGACCCCGGAAT
TTAAGCGCGACCTGCAGCTGATCAAGATGCGTGGCGTCCTTGACCCCCAC
CGCCACTACAAGAAGGACAACTCTTCCTTTCCAGAATATTCCCAGGTTGG
GACCATTGTGGAAGGAAACGCCGACTATTTCTCCTC

Sequences in the Contig:

SY0AAB37YN04FM1